UTR-LM¶
Predict 5'UTR expression metrics: mean ribosome loading, translation efficiency, or expression level.
- Paper: Nature Machine Intelligence 2024
- Upstream: https://github.com/a96123155/UTR-LM
- License: GPL-3.0
- Device: CPU or GPU (lightweight ~5M parameter model). Two image variants:
rnazoo-utrlm:latest— CUDA-enabled (default, used with-profile gpu)rnazoo-utrlm-cpu:latest— CPU-only (smaller, used with-profile cpu)
What it does¶
UTR-LM is a 5'UTR language model pretrained on RNA sequences from 5 species using masked language modeling with secondary structure and minimum free energy supervision. It predicts expression-related metrics from 5'UTR sequences:
- MRL (Mean Ribosome Loading): from synthetic 50-nt UTR library (Sample et al.)
- TE (Translation Efficiency): log-transformed, cell-line specific
- EL (Expression Level): log-transformed RNA-seq expression, cell-line specific
Input format¶
FASTA file of 5'UTR DNA sequences (A, C, G, T alphabet; U is auto-converted to T):
>synthetic_utr_1
AATTCCGGAATTCCGGAATTCCGGAATTCCGGAATTCCGGAATTCCGGAA
>synthetic_utr_2
GCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGC
- MRL task: uses 50-nt sequences (last 50 nt if longer)
- TE/EL tasks: uses last 100 nt of the 5'UTR
Shorter sequences are automatically padded.
Output format¶
predictions.tsv — one prediction per sequence:
header sequence mean_ribosome_loading
synthetic_utr_1 AATTCCGGAATTCCGGAATTCCGGAATTCCGGAATTCCGGAATTCCGGAA 8.053340
synthetic_utr_2 GCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGC 5.337085
synthetic_utr_3 TGATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGATG 6.575327
Run with Docker¶
See the Direct Docker guide for the shared
docker runrecipe (UID,HOME,USERenv vars, and GPU flag). Below are the model-specific parts.
# CPU — MRL prediction
docker run --rm \
-v /path/to/input.fa:/data/input.fa \
-v /path/to/output:/out \
ghcr.io/ericmalekos/rnazoo-utrlm-cpu:latest \
utrlm_predict.py -i /data/input.fa -o /out --task mrl --model-dir /opt/utrlm/Model
# GPU — same command, swap image and add nvidia runtime
docker run --rm --runtime=nvidia -e NVIDIA_VISIBLE_DEVICES=all \
-v /path/to/input.fa:/data/input.fa \
-v /path/to/output:/out \
ghcr.io/ericmalekos/rnazoo-utrlm:latest \
utrlm_predict.py -i /data/input.fa -o /out --task mrl --model-dir /opt/utrlm/Model
For TE/EL prediction add --task te|el --cell-line HEK|pc3|Muscle.
Run with Nextflow¶
# CPU
nextflow run main.nf -profile docker,cpu --utrlm_input /path/to/input.fa --utrlm_task mrl
# GPU
nextflow run main.nf -profile docker,gpu --utrlm_input /path/to/input.fa --utrlm_task mrl
Only models with input provided will run — no ignore flags needed.
Results appear in results/utrlm/utrlm_out/.
Parameters¶
| Parameter | Default | Description |
|---|---|---|
--utrlm_task |
mrl |
Prediction task: mrl, te, or el |
--utrlm_cell_line |
HEK |
Cell line for TE/EL tasks: HEK, pc3, or Muscle |
--utrlm_checkpoint |
null |
Path to a fine-tuned .pt checkpoint to use instead of the bundled pretrained weights |
Available tasks¶
| Task | Label | Input Length | Cell Lines | Description |
|---|---|---|---|---|
mrl |
Mean Ribosome Loading | 50 nt | N/A | From synthetic UTR library |
te |
Translation Efficiency (log) | 100 nt | HEK, pc3, Muscle | Cell-line specific |
el |
Expression Level (log) | 100 nt | HEK, pc3, Muscle | RNA-seq based |
Fine-tuning on your own data¶
Known issue (tracked, not yet fixed). As of 2026-05-03 the fine-tune workflow below reaches the training loop but errors during the first batch with
ValueError: not enough values to unpack (expected 4, got 2)from UTR-LM's custom ESMBatchConverter. Thecollatefunction inbin/utrlm_finetune.pyemits 2-tuples(label, seq)while the upstream fork expects 4-tuples(label, seq, masked_seq, masked_indices). A previous PATH-invocation bug masked this; that's now fixed (modules/local/utrlm_finetune.nfinvokes${projectDir}/bin/utrlm_finetune.py), so the deeper issue is reachable. The collate fix is on the backlog — see project notes. The inference (utrlm_predict.py) and prediction-from-checkpoint paths are unaffected. For supervised tasks on 5'UTR sequences in the meantime, the foundation-model head trainer on RNA-FM / RiNALMo / mRNABERT embeddings is a working alternative.
UTR-LM can be fine-tuned on your own expression data (MRL, TE, or EL measurements for 5'UTR sequences).
Input format¶
CSV or TSV file with columns: name, utr (5'UTR sequence), and a numeric label column. Example:
Step 1: Fine-tune¶
nextflow run main.nf -profile docker,cpu \
--utrlm_finetune_input my_training_data.csv \
--utrlm_finetune_label my_mrl \
--utrlm_finetune_task mrl
Output: results/utrlm_finetune/utrlm_finetune_out/best_model.pt (fine-tuned checkpoint) + results/utrlm_finetune/utrlm_finetune_out/predictions.tsv.
Step 2: Predict with fine-tuned model¶
Use the saved checkpoint for subsequent predictions on new sequences:
nextflow run main.nf -profile docker,cpu \
--utrlm_input new_sequences.fa \
--utrlm_checkpoint results/utrlm_finetune/utrlm_finetune_out/best_model.pt \
--utrlm_task mrl
Fine-tuning parameters¶
| Parameter | Default | Description |
|---|---|---|
--utrlm_finetune_label |
(required) | Column name with target values |
--utrlm_finetune_task |
mrl |
Task type: mrl, te, or el (determines backbone + input length) |
--utrlm_finetune_epochs |
100 |
Training epochs |
--utrlm_finetune_patience |
20 |
Early stopping patience |
--utrlm_finetune_lr |
0.01 |
Learning rate |
--utrlm_finetune_batch_size |
32 |
Mini-batch size during training |
--utrlm_finetune_val_frac |
0.2 |
Fraction of training rows held out for validation |
--utrlm_finetune_pretrained |
(none) | Optional: initialize from an existing checkpoint |
Technical notes¶
- Uses a custom fork of Facebook's ESM library with RNA-specific alphabet and secondary structure heads.
- Architecture: 6-layer ESM2 transformer (128-d, 16 heads) + linear classification head.
- Weights are bundled in the upstream repo (~1.1 GB total for all tasks/folds).
- MRL has 1 fold; TE/EL have 10 folds each (use
--folds allfor ensemble averaging). - The model uses the CLS/BOS token embedding for per-sequence prediction.