RNAErnie¶
Extract RNA embeddings from a 12-layer ERNIE-framework transformer pretrained with motif-aware multi-level masking and type-guided fine-tuning.
- Paper: Nature Machine Intelligence 2024
- Upstream (original PaddlePaddle): https://github.com/CatIIIIIIII/RNAErnie (MIT)
- HF port used here:
LLM-EDA/RNAErnie— official PyTorch port, Apache-2.0, 2048-token context - License: Apache-2.0 (weights). RNAErnie's vocab is just A/U/C/G/N + 6 special tokens, so the wrapper bakes a tiny char-level tokenizer in directly and loads weights via
transformers.BertModel.from_pretrained(...)— no extra packages needed. - Device: CPU or GPU. Two image variants:
rnazoo-rnaernie:latest— CUDA-enabled (default, used with-profile gpu)rnazoo-rnaernie-cpu:latest— CPU-only (smaller, used with-profile cpu)
What it does¶
RNAErnie is a 12-layer, 768-dimensional transformer pretrained on ~23M ncRNA sequences from RNAcentral. Its distinguishing feature is motif-aware pretraining: in addition to standard masked language modeling at base and subsequence levels, the pretraining objective also masks RNA motifs from a curated motif database, encouraging the model to learn biologically meaningful k-mer patterns. At fine-tuning time, the paper proposes a type-guided fine-tuning strategy where the model first predicts a coarse-grained RNA type (miRNA, lncRNA, etc.) and appends the predicted type as auxiliary information to refine the embedding.
The pipeline currently exposes only the inference path (per-sequence and optional per-token embeddings). Type-guided fine-tuning is a future addition (TODO in the fine-tuning support table).
Input format¶
FASTA file of RNA sequences using RNA alphabet (A, C, G, U). DNA sequences (with T) are automatically converted to U.
Maximum sequence length: 2046 nt. The LLM-EDA port has a 2048 max-position-embedding limit; CLS+SEP consume 2 slots, so raw inputs are capped at 2046. Longer sequences are truncated with a warning.
Example (reuses tests/data/rnafm_test.fa):
>test_rna_1
GGGUGCGAUCAUACCAGCACUAAUGCCCUCCUGGGAAGUCCUCGUGUUGCACCUGACUGUCUUUCCGAACGGGCGUUUCUUUUCCUCCGCGCUACCUGCCAGG
>test_rna_2
AUUCCGAGAGCUAACGGAGAACUCUGUUCGAUUUAAGCUGUAAGAUGGCAGUAGCUUACUAGGCAGGAAAAGACCCUGUUGAGCUUGACUCUAGUU
Output format¶
A directory containing:
sequence_embeddings.npy: NumPy array of shape(N, 768)— one 768-d embedding per input sequence (mean-pooled across non-special positions, matching the convention used by RNA-FM / RiNALMo / Orthrus wrappers; ERNIE-RNA's wrapper is the lone exception in the zoo and uses [CLS]-pooling instead)labels.txt: one FASTA header per line, in the same order as the embedding rows
With --per-token:
<label>_tokens.npy: per-sequence NumPy array of shape(L, 768)— one 768-d embedding per nucleotide position
Run with Docker¶
See the Direct Docker guide for the shared
docker runrecipe (UID,HOME,USERenv vars, and GPU flag). Below are the model-specific parts.
# CPU
docker run --rm \
-v /path/to/input.fa:/data/input.fa \
-v /path/to/output:/out \
ghcr.io/ericmalekos/rnazoo-rnaernie-cpu:latest \
rnaernie_predict.py -i /data/input.fa -o /out
# GPU
docker run --rm --runtime=nvidia -e NVIDIA_VISIBLE_DEVICES=all \
-v /path/to/input.fa:/data/input.fa \
-v /path/to/output:/out \
ghcr.io/ericmalekos/rnazoo-rnaernie:latest \
rnaernie_predict.py -i /data/input.fa -o /out
Add --per-token to either invocation for per-token embeddings.
Run with Nextflow¶
# CPU
nextflow run main.nf -profile docker,cpu --rnaernie_input /path/to/input.fa
# GPU
nextflow run main.nf -profile docker,gpu --rnaernie_input /path/to/input.fa
Only models with input provided will run — no ignore flags needed.
Results appear in results/rnaernie/rnaernie_out/.
Parameters¶
| Parameter | Default | Description |
|---|---|---|
--rnaernie_per_token |
false |
Also output per-token (L x 768) embeddings per sequence |
--rnaernie_max_len |
2046 |
Truncate inputs to this many nt (RNAErnie's positional-embedding cap, 2048 minus CLS+SEP) |
--rnaernie_batch_size |
8 |
Sequences per forward pass; lower if you hit GPU OOM |
Reading the output¶
import numpy as np
embeddings = np.load("rnaernie_out/sequence_embeddings.npy") # (N, 768)
labels = open("rnaernie_out/labels.txt").read().strip().split("\n")
for label, emb in zip(labels, embeddings):
print(f"{label}: {emb.shape}") # (768,)
Comparison with the other foundation models in the zoo¶
| Model | Embedding | Pooling | Architecture | Training set | Max input | Bundled license |
|---|---|---|---|---|---|---|
| RNA-FM | 640-d | Mean (excl CLS+EOS) | 12-layer transformer | 23M ncRNAs (RNAcentral) | 1022 nt | MIT |
| RiNALMo | 1280-d | Mean (excl CLS+EOS) | 33-layer transformer (650M params) | 36M ncRNAs (RNAcentral) | ~11k nt (memory-bound) | Apache-2.0 |
| ERNIE-RNA | 768-d | [CLS] | 12-layer + structure-aware attention | 20M ncRNAs (RNAcentral) | 1022 nt | MIT |
| RNAErnie | 768-d | Mean (excl CLS+SEP) | 12-layer transformer + motif-aware MLM | 23M ncRNAs (RNAcentral) | 2046 nt | Apache-2.0 |
| Orthrus | 512-d | Mean (mean_unpadded) |
Mamba SSM (10M params) | 32.7M mRNAs (GENCODE+RefSeq) | unbounded (linear mem) | MIT |
RNAErnie's unique angle is motif-aware pretraining + the type-guided fine-tuning strategy in the paper. Recent benchmarks place it intermediate on classification and below RiNALMo / ERNIE-RNA on secondary structure — useful as a complementary embedding for ensemble work, not a strict upgrade over what's already in the zoo.
Limitations¶
- Maximum input length is 2046 nt — short ncRNAs and miRNAs fit comfortably; longer mRNAs (>2 kb) must be truncated or chunked. For long mRNAs use Orthrus (Mamba, linear memory).
- Inference-only currently. Type-guided fine-tuning is in upstream and exists as a TODO in the fine-tuning support table.
Fine-tuning¶
RNAZoo exposes a generic head trainer (linear / MLP / XGBoost, regression or classification) on top of frozen 768-d RNAErnie embeddings. See the Fine Tuning guide for input format, head choice, the two execution paths (full chain vs. precomputed embeddings), and worked examples.
RNAErnie-specific parameters¶
| Parameter | Default | Description |
|---|---|---|
--rnaernie_finetune_input |
null |
TSV/CSV with name, sequence, label column |
--rnaernie_finetune_label |
(required) | Column name with target values |
--rnaernie_finetune_embeddings |
null |
Precomputed (N, D) .npy — switches to the head-only path |
--rnaernie_finetune_head_type |
linear |
linear, mlp, or xgboost (xgboost requires _embeddings) |
--rnaernie_finetune_task |
auto |
auto, regression, or classification |
--rnaernie_finetune_epochs |
20 | Max training epochs (torch heads) |
--rnaernie_finetune_lr |
1e-3 | Adam (torch) or XGBoost learning rate |